Skip to main content

Table 1 Nucleotide sequence of primers used in PCR amplification and sequencing

From: Isolation of equid alphaherpesvirus 3 from a horse in Iceland with equine coital exanthema

Gene Primers sequence 5′–3′ Locationa Amplicon size (bp) GenBank no Size of sequence strand (bp)
Glycoprotein G
 Forward ACCACCTGCGAGACCATTAC 566–585 616 MN689934 590
 Reverse TAGTTGGTCCCCTTCTGCTG 1162–1181
DNA polymerase
 Forward CCCGTTGATGACCCCTATGT 822–841 321 MN689935 321
 Reverse TAGCAGCATGTCTCGCCC 1125–1142
  1. aLocation starting for the first start codon, is based on EHV-3 strain, AR/2007/C3A (GenBank no NC_024771.1)