Skip to main content

Table 1 Primer sequences and expected PCR product sizes

From: Rapid detection of Salmonella enterica serovar Typhimurium DT104 strains by the polymerase chain reaction

Primer Nucleotide sequence (5′–3′) Product size (bp)
ST104F TACCGCCATTCGCATAAACG 312
ST104R CAGAGGTTGGTATTGTAGCG
DT104F GTCAGCAGTGTATGGAGCGA 162
DT104R AGTAGCGCCAGGACTCGTTA
InvA-F TTGTTACGGCTATTTTGACCA 521
InvA-R CTGACTGCTACCTTGCTGATG
  1. bp base pairs