Skip to main content

Table 1 Sequences, amplification product size, and GenBank accession number of amplification genes of rats

From: Characterization of TLR2, NOD2, and related cytokines in mammary glands infected by Staphylococcus aureus in a rat model

Gene Primer sequence (5ʹ to 3ʹ) Product (bp) Accession number
Gapdh F:CCAGCAAGGATACTGAGAGCAA 101 NM_017008.4
R:GGATGGAATTGTGAGGGAGATG
TLR2 F:CAAACTGGAGACTCTGGAAGCA 120 NM_198769.2
R:AGGTAGCTGTCTGGCCAGTCA
NOD2 F: ACAAAGACGCCGACACTATACTG 241 NM_001106172.1
R: TCAAGGAGGAACTGGAAGACG
TNF-α F: GTAGCCCACGTCGTAGCAA 217 NM_012675.3
R: AAGTGGCAAATCGGCTGAC
IL-1β F:GCAATGGTCGGGACATAGTT 152 NM_031512.2
R:GACTTGGCAGAGGACAAAGG
IL-6 F: CACAAGTCCGGAGAGGAGAC 168 NM_012589.2
R: ACAGTGCATCATCGCTGTTC
CXCL1 F:GGCGGAGAGATGAGAGTCTG 182 NM_030845.1
R:AGGCATTGTGCCCTACAAAC
IL-10 F:CACTGCTATGTTGCCTGCTCTTACT 73 NM: _012854.2
R: TTATTGTCACCCCGGATGGA
TGF-β F:CAACAATTCCTGGCGTTACCTT 121 NM_021578.2
R:CTGTATTCCGTCTCCTTGGTTCA
IFN-γ F: AGGAACTGGCAAAAGGACG 196 NM_138880.2
R: CGAACTTGGCGATGCTCAT